La purezza della forma: Johann Sebastian Bach e Maurits Cornelis Escher

mostra-Escher-a-Milano-5

UMBERTO BECCARIA.

Il percorso che voglio intraprendere deriva dall’osservazione delle opere di Maurits Cornelis Escher, autore che ho collegato ad uno dei musicisti più importanti nella mia esperienza,  Johann Sebastian Bach. Per iniziare la riflessione, propongo uno spunto “visivo” decisamente interessante. Prendiamo ad esempio una Fuga dal primo libro del “Clavicembalo ben Temperato” del musicista tedesco e una delle opere più importanti dell’incisore, “Relatività”.

Relatività Escher

Relatività, 1953

Prima Fuga Clav. ben Temperato Bach

Prima Fuga a 4 voci in Do Maggiore, BWV 846

Prima di esplicitare i termini di paragone tra le due espressioni artistiche, è necessario fornire alcune delucidazioni sulla Fuga. Questo termine indica, in ambito musicale,  una forma contrappuntistica a imitazione. Il contrappunto consiste nell’arte di sovrapporre differenti melodie giungendo ad un sistema musicale compiuto. Per imitazione, invece, si intende il procedimento secondo il quale vengono ripetuti da più voci nuclei melodici presentati da un’altra voce. La fuga si articola in tre momenti: l’esposizione, lo svolgimento e lo stretto. Non è necessario dilungarsi su questi aspetti, nella mia analisi prendo in considerazione solamente la prima di queste tre sezioni.

Nella parte iniziale della fuga, come si può vedere dall’esemplificazione utilizzata, il tema viene enunciato per intero e in successione da tutte le voci. Come si può notare, c’e simmetria, anche visiva, in questo procedimento musicale.

Evidenziazione Voci Prima Fuga Clav. ben Temperato Bach

In questa immagine le quattro voci evidenziate nell’esposizione della fuga. 

Torniamo all’opera di Escher. “Relatività” presenta molti piani differenti ma che contengono tutti un concetto analogo. Non accade forse lo stesso in una Fuga? L’opera dell’incisore olandese può essere vista da molti punti di vista ma nessuno risulta essere definitivo. Egli avrebbe potuto andare avanti all’infinito nella sua rappresentazione, aggiungendo scale, personaggi, strutture. Lo stesso Bach potrebbe essere andato oltre e aver inserito voci senza fermarsi.

Tutti e due, ovviamente, sono stati costretti a restare in determinati confini: per l’incisore lo spazio del foglio, per il compositore il vincolo di non oltrepassare le quattro voci, ma il messaggio rimane immutato. Il richiamo alla circolarità del tempo nell’universo, all’eternità, e ai misteri della vita umana sono presenti sia in Escher che in Bach.

Iniziare da questa analogia è essenziale per comprendere la vicinanza tra le due espressioni artistiche, seppur sviluppate a secoli di distanza. L’opera di Escher è denotata da implicazioni matematiche scaturite da tutta la sua produzione, che spesso precedono le ricerche degli specialisti contemporanei o ne accompagnano lo studio con una portentosa contemporaneità.  L’incisore olandese si rapporta con un universo geometrico, con il concetto di spazio e di infinito, del tempo e dell’eternità sopraccitati. Questi aspetti caratterizzano certamente anche l’opera di Bach, non compreso dai suoi contemporanei ma soltanto decenni dopo. I due artisti costituiscono in parte un unicum ma non si può asserire che siano slegati dagli intrecci artistici e culturali della loro epoca.

Ogni grande artista ha un piede nel passato e un piede nel futuro, la capacità di rinnovare l’espressione è appannaggio del genio. Questi due grandi uomini compiono il loro percorso in momenti storici diversi ma con una novità grandiosa. Abbiamo visto come la produzione di J.S. Bach abbia implicazioni trascendenti (oserei dire che tutti le grandi composizioni ne abbiano), ma anche aspetti strettamente legati alla matematica e alla geometria. L’incisore olandese, a sua volta, riesce a creare paradossi con le sue immagini: esse devono infatti considerarsi riflessioni a problemi e teoremi di geometria euclidea e non euclidea.

Il percorso che ho intrapreso vuole mostrare la ricchezza celata dietro le più mirabili espressioni della mente umana e come sarebbe riduttivo guardare alle arti come entità a sé stanti. Tra di esse vi è infatti un rapporto di interazione fruttuosa che, se compresa e colta, può portare l’uomo alla piena realizzazione. A questo punto non posso dimenticare l’immenso studio del filosofo Douglas Hofstadter, il quale, partendo proprio dal legame tra Escher, Bach e Gödel (matematico e logico), ha intrapreso un cammino per spiegare quale sia la logica delle strutture submolecolari del DNA.

Lo studioso utilizza nella sua disquisizione il concetto di canone cancrizzante, che assume valore essenziale e grande efficacia nell’applicazione al DNA. In musica, il canone è un procedimento molto usato, soprattutto in composizioni di tipo polifonico, come la fuga. Esso consiste nel fare iniziare una melodia da una sola parte e di farla seguire, dopo un determinato intervallo di tempo, da una diversa parte che imita in modo rigoroso il disegno melodico della prima voce che ha esposto. Nel caso in cui il canone abbia più di due voci, le entrate di queste ultime seguono a distanze che possono anche essere irregolari. Hofstadter si serve di quello cancrizzante, ossia del procedimento secondo il quale il conseguente riproduce esattamente l’antecedente (anche nei valori di durata delle note), ma a ritroso, ossia dall’ultima nota alla prima.

Il filosofo americano, tramite il dialogo tra Achille e Tartaruga, i due personaggi che hanno radici nel pensiero greco e poi ripresi da Lewis Carrol, illustra il suo ragionamento. I due protagonisti, passeggiando, si scambiano opinioni sui rispettivi gusti artistici (Escher è l’artista prediletto di Achille). Subentra dunque un altro personaggio, il Granchio, che simboleggia il canone cancrizzante. Questi spiega come per lui l’avanzare e l’indietreggiare siano la medesima cosa, simboleggiando quanto asserito in precedenza in via puramente teorica. La disquisizione di Hofstadter continua con un dialogo tra Achille e Tartaruga, come nella prima parte, ma l’argomento nodale non è più relativo ai gusti artistici, ma a quelli musicali: Bach è l’artista preferito dalla Tartaruga. Il dialogo riproduce le stesse frasi che, seppur rovesciate, mantengono un senso. Nella visione di Hofstadter, ciò che deriva da questo procedimento è un eventuale gene del granchio (“granChio”) (GC). Tutto può essere schematizzato in questo modo, come struttura del DNA:

TTTTTTTTTGCAAAAAAAAA

AAAAAAAAACGTTTTTTTTT

A è l’Adenina, T è la Timina, ma potrebbero essere anche Achille e Tartaruga.

Lo studioso americano presenta in questi passi osservazioni che legano molto con quanto affermato in apertura. Hofstadter sostiene: “Bach amava particolarmente le inversioni, e i canoni compaiono spesso nella sua opera”, a sottolineare il fatto che le sue composizioni si organizzassero sul pentagramma in modo speculare. Il filosofo sposta la sua attenzione sull’opera che Bach dedicò a Federico il Grande, re di Prussia: l’Offerta Musicale. Al capolavoro del musicista viene affiancata l’opera di Escher in cui sono rappresentati granchi di colore differente che si alternano seguendo linee orientate in versi opposti.

É necessario chiarire che lo stesso incisore olandese era consapevole della condivisione di valori con l’opera di Bach. Grazie ad importanti filmati è stato possibile stabilire l’utilizzo di composizioni dal Clavicembalo ben Temperato da parte dell’artista e di notare come Escher le abbia affiancate al suo lavoro. Il riferimento è al Primo Preludio e Fuga da cui è scaturita la mia osservazione.